|
Addgene inc
plko 1 orf45 shrna 2 Plko 1 Orf45 Shrna 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 orf45 shrna 2/product/Addgene inc Average 96 stars, based on 1 article reviews
plko 1 orf45 shrna 2 - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Millipore
plko.1-eif3l shrna1 (5′ ccggcct ggtagacaaatccaacatctcgagatgttggatt tgtctaccaggtttttg 3′) Plko.1 Eif3l Shrna1 (5′ Ccggcct Ggtagacaaatccaacatctcgagatgttggatt Tgtctaccaggtttttg 3′), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko.1-eif3l shrna1 (5′ ccggcct ggtagacaaatccaacatctcgagatgttggatt tgtctaccaggtttttg 3′)/product/Millipore Average 90 stars, based on 1 article reviews
plko.1-eif3l shrna1 (5′ ccggcct ggtagacaaatccaacatctcgagatgttggatt tgtctaccaggtttttg 3′) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 shrna Plko 1 Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 shrna/product/Addgene inc Average 93 stars, based on 1 article reviews
plko 1 shrna - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Addgene inc
lentiviral plko.1 plasmids Lentiviral Plko.1 Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lentiviral plko.1 plasmids/product/Addgene inc Average 90 stars, based on 1 article reviews
lentiviral plko.1 plasmids - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 shrna2 control scramble ![]() Plko 1 Shrna2 Control Scramble, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 shrna2 control scramble/product/Addgene inc Average 90 stars, based on 1 article reviews
plko 1 shrna2 control scramble - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
shrnas for deptor ![]() Shrnas For Deptor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shrnas for deptor/product/Addgene inc Average 94 stars, based on 1 article reviews
shrnas for deptor - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 usp10 shrna 2 ![]() Plko 1 Usp10 Shrna 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 usp10 shrna 2/product/Addgene inc Average 93 stars, based on 1 article reviews
plko 1 usp10 shrna 2 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Addgene inc
2014 vib ugent vector id ![]() 2014 Vib Ugent Vector Id, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/2014 vib ugent vector id/product/Addgene inc Average 93 stars, based on 1 article reviews
2014 vib ugent vector id - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
GenScript corporation
plko.1-snail-shrna2 ![]() Plko.1 Snail Shrna2, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko.1-snail-shrna2/product/GenScript corporation Average 90 stars, based on 1 article reviews
plko.1-snail-shrna2 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
lentiviral plko 1 plasmids targeting hoxa10 ![]() Lentiviral Plko 1 Plasmids Targeting Hoxa10, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lentiviral plko 1 plasmids targeting hoxa10/product/Addgene inc Average 92 stars, based on 1 article reviews
lentiviral plko 1 plasmids targeting hoxa10 - by Bioz Stars,
2026-03
92/100 stars
|
Buy from Supplier |
|
Addgene inc
shrna2 ![]() Shrna2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shrna2/product/Addgene inc Average 93 stars, based on 1 article reviews
shrna2 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Millipore
plko.1 ttk shrna2 (trcn0000011012) ![]() Plko.1 Ttk Shrna2 (Trcn0000011012), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko.1 ttk shrna2 (trcn0000011012)/product/Millipore Average 90 stars, based on 1 article reviews
plko.1 ttk shrna2 (trcn0000011012) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell
Article Title: A membrane-less organelle associated with the endoplasmic reticulum enables 3′UTR-mediated protein-protein interactions
doi: 10.1016/j.cell.2018.10.007
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet:
Techniques: Recombinant, Blocking Assay, Protease Inhibitor, Reverse Transcription, Mutagenesis, Plasmid Preparation, Control, Luciferase, shRNA, Software
Journal: Scientific Reports
Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes
doi: 10.1038/s41598-023-50318-7
Figure Lengend Snippet: Role of HOXA10 in Gdf5 expression in articular cartilage cells. ( A ) SFZ cells isolated from WT mice were infected with empty (control) or indicated lentiviruses. Indicated gene expression was analyzed by RT-qPCR in duplicate. ( B ) Schematic diagram of Gdf5 -HiBiT screening system. ( C ) SFZ cells were isolated from Gdf5- HiBiT KI mice and were plated on a 96-well plate. Gdf5- HiBiT KI SFZ cells were infected with the indicated lentiviruses. One day later, the medium was changed. The cells were cultured for 2 days and then the supernatants were collected. The supernatants were subjected to HiBiT measurement (n = 3). RLU: relative light unit. ( D ) SFZ cells isolated from WT mice were infected with empty (control) or FLAG- Hoxa10 lentiviruses. Hoxa10 , Gdf5 , and Prg4 expression was analyzed by RT-qPCR (n = 3). ( E ) SFZ cells isolated from WT mice were infected with empty (control), shHoxa10-1, or shHoxa10-2 lentiviruses. Hoxa10 , Gdf5 , and Prg4 expression was analyzed by RT-qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, ****: P < 0.0001).
Article Snippet: For knockdown experiments,
Techniques: Expressing, Isolation, Infection, Control, Gene Expression, Quantitative RT-PCR, Cell Culture
Journal: Scientific Reports
Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes
doi: 10.1038/s41598-023-50318-7
Figure Lengend Snippet: Role of HOXA10 in Gdf5 expression in LB cells. ( A ) LB cells were isolated from Gdf5- HiBiT KI mice and plated on a 96-well plate. The cells were infected with empty (control), Venus , or FLAG- Hoxa10 lentiviruses. One day after infection, the medium was changed. The cells were cultured for 2 days and then the supernatants were collected. The supernatants were subjected to HiBiT measurement (n = 3). RLU: relative light unit. ( B ) LB cells isolated from WT mice were infected with empty (control), Venus , or FLAG- Hoxa10 lentiviruses. Hoxa10 , Gdf5 , and Prg4 expression was analyzed by RT-qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, **: P < 0.01).
Article Snippet: For knockdown experiments,
Techniques: Expressing, Isolation, Infection, Control, Cell Culture, Quantitative RT-PCR
Journal: Scientific Reports
Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes
doi: 10.1038/s41598-023-50318-7
Figure Lengend Snippet: Effect of HOXA10 on the Gdf5 gene promoter. ( A ) The ATAC-Seq database (articular chondrocytes: SRX13791211, costal chondrocytes: SRX11156876) from ChIP-Atlas was analyzed by integrative genomics viewer IGV2.8.6. A Gdf5 gene promoter (1393 bp) exhibits an open chromatin region on the Gdf5 gene in articular chondrocytes. ( B ) Schematic diagram of luciferase reporter construction with mouse Gdf5 gene promoter (− 1081 to + 312). A putative HOXA10 binding motif (− 538 to − 529) is shown with reference to previous study . ( C ) HEK293T cells were transfected with empty or FLAG- Hoxa10 plasmids as well as luciferase reporter plasmids with mouse Gdf5 gene promoter. Cell lysates were subjected to luciferase measurement (n = 4). RLU: relative light unit. ( D ) SFZ cells isolated from WT mice were infected with empty (control) or FLAG- Hoxa10 lentiviruses. Gdf5 gene promoter fragments collected by ChIP using anti-FLAG antibody were analyzed by real-time qPCR (n = 3). Data are the mean ± SEM (*: P < 0.05, ****: P < 0.0001).
Article Snippet: For knockdown experiments,
Techniques: Luciferase, Binding Assay, Transfection, Isolation, Infection, Control
Journal: Scientific Reports
Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes
doi: 10.1038/s41598-023-50318-7
Figure Lengend Snippet: Immunofluorescent analysis of HOXA10 and GDF5 in articular cartilage. Tibial sections from 3-month-old mice were subjected to co-immunostaining with anti-HOXA10 and anti-GDF5 antibodies. DAPI indicates nucleus. Scale bar, 50 μm.
Article Snippet: For knockdown experiments,
Techniques: Immunostaining
Journal: Scientific Reports
Article Title: HOXA10 promotes Gdf5 expression in articular chondrocytes
doi: 10.1038/s41598-023-50318-7
Figure Lengend Snippet: List of transcription factor genes predominantly expressed in articular chondrocytes by microarray analysis.
Article Snippet: For knockdown experiments,
Techniques: Microarray